Inflammation is a protective response of immune cells, such as lymphocytes, during emergencies, such as antigen invasion or tissue damage. Inflammation is primarily categorized into acute and chronic responses. Acute inflammation is triggered by mediators, such as histamines, bradykinins, and prostaglandins, and manifests with various symptoms, including pain, fever, redness, swelling, and loss of function [1]. Lipopolysaccharide (LPS), an endotoxin secreted by gram-negative bacteria, is one of the antigens that induce inflammation [2]. Several studies have reported that LPS plays a role in inducing acute inflammation during bacterial infections, leading to organ damage and sepsis [3-6].

Nonsteroidal anti-inflammatory drugs are commonly used to suppress excessive inflammatory responses owing to their anti-inflammatory, analgesic, and antipyretic properties. However, these drugs have been associated with various side effects, including gastrointestinal bleeding, ulcers, dyspepsia, myocardial infarction, and renal failure [7-11]. Consequently, there is a growing demand for the development of effective anti-inflammatory agents with fewer side effects.

Aconitum ciliare Decaisne (ACD), a known potent and toxic compound, has been traditionally used to treat pain-related conditions, such as rheumatism, joint pain, and sciatica [12]. Recent experimental studies have reported the anti-inflammatory effects of ACD in chronic arthritis [10]. Furthermore, the reformation of ACD has led to the development of Aconitum ciliare Decaisne pharmacopuncture (ADP), in which aconitine is converted to aconine, thereby removing the toxic components and ensuring safety [13,14]. Despite these developments, research on ACD and ADP has mainly focused on noninfectious and chronic inflammatory diseases like chronic arthritis and peripheral neuropathy. To date, no studies in Korea have quantified and analyzed the effects of ADP on infectious inflammation induced by external antigens. Thus, this study aimed to investigate the significant effects of ADP on infectious inflammatory responses by conducting in vitro experiments using LPS- activated RAW 264.7 macrophages.

1. Material

1) Sample

The ADP used in this study was purchased from the Girin Oriental Medicine Clinic’s external decoction room (Wonju, Korea).

2) Reagents

The reagents used were as follows: trypan blue, LPSs from Escherichia coli O111:B4, celecoxib, protease inhibitor cocktail and phosphatase inhibitor cocktail (Sigma-Aldrich), ethanol and methanol (Merck), EZ-Cytox (DoGenBio), Dulbecco’s Modified Eagle Medium (DMEM), Fetal Bovine Serum (FBS), and Penicillin-Streptomycin (Welgene), Nitric Oxide Plus Detection Kit, easy-spin™ Total RNA Extraction Kit, Acrylamide-Bis Solution 30%, 1.5 M Tris-HCl (pH 8.8), 0.5 M Tris-HCl (pH 6.8), 10X Tris-Glycine-SDS Buffer, GangNam-STAIN™ prestained protein ladder, 10X Transfer Buffer, 10X Tris-Buffered Saline (TBS) with Tween 20, Miracle-Star™ Western Blot Detection System (iNtRON Biotechnology), AccuPower^® CycleScript™ RT Premix (dT20) and DEPC-DW (Bioneer), qPCRBIO SyGreen^® Blue Mix Lo-ROX (PCR Biosystems), prostaglandin E2 (PGE2) Parameter Assay Kit (R&D Systems), mouse interleukin-1 beta (IL-1β), IL-6, and tumor necrosis factor-alpha (TNF-α) ELISA Kits (Komabiotech), RIPA Lysis and Extraction Buffer, Pierce™ Bicinchoninic Acid (BCA) Protein Assay Kit, 10% Ammonium Persulfate (Thermo Fisher Scientific), Sample Buffer (ELPISbiotech), TEMED (Bio-RAD), Ultra Pure Bovine Serum Albumin (BSA; GenDEPOT), inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), IL-1β, IL-6, TNF-α, Phospho-p44/42 MAPK (ERK1/2), p44/42 MAPK, Phospho-SAPK/JNK, SAPK/JNK, Phospho-p38 MAPK, p38 MAPK, and β-actin antibodies (Cell Signaling Technology), peroxidase-conjugated affinitive goat antirabbit immunoglobulin (IgG; H + L) and peroxidase-conjugated affinitive goat antimouse IgG (H + L; Jackson Immunoresearch), and isoflurane (Hana Pharm Co.).

3) Equipment

The following equipment was used in this study: extraction mantle (Misung Scientific), rotary vacuum evaporator (EYELA), freeze-dryer (ilShinbiobase), CO₂ incubator, autoclave, deep-freezer (Sanyo), clean bench (Vision Scientific), vortex mixer, centrifuge, ice-maker (Vision Scientific), plate shaker (Lab-Line), microplate reader (Molecular Devices), NanoDrop (Thermo Fisher Scientific), polymerase chain reaction (PCR) cycler (Alpha Cycler 1, PCRmax), real-time PCR cycler (Exicycler™ 96, Bioneer), ChemiDoc (Fusion FX), and hematology system ADVIA 2120i (Siemens Healthineers).

2. Methods

1) Cell culture

RAW264.7 cells (Korean Cell Line Bank) were cultured in DMEM with 10% FBS at a temperature of 37℃ in a 5% CO₂ incubator. The subcultures were performed every 2–3 days.

2) Cell viability measurement

The RAW264.7 cells were plated in a 48-well plate at 2 × 10⁴ cells/well and cultured for 24 hours. Subsequently, the ADP was added at 1%, 5%, 10%, and 20% concentrations for 24 hours. Then, the EZ-Cytox solution was added to the medium, and after 30 minutes, the absorbance at 450 nm was measured. Cell viability was expressed as a percentage relative to the control.

3) Cell sample preparation

The RAW264.7 cells were plated in a 6-well plate at a density of 1 × 10⁵ cells/well, cultured for 24 hours, and then treated with ADP (5% and 10%) and 500 ng/mL LPS for an additional 24 hours. After culturing, the cells and media were separated and stored at a temperature of −80℃ for analysis.

4) Measurement of nitric oxide production

Culture medium (200 µL) was added to a 96-well plate and mixed with 100 µL of N1 buffer. The mixture was incubated for 10 minutes. Moreover, 100 µL of N2 buffer was added, and the incubation was continued for another 10 minutes. The absorbance at 540 nm was measured, and the NO production was expressed as a percentage relative to the control.

5) Grouping of subjects

The participants were divided into four groups: a normal group with no treatment (n = 6), control group receiving LPS without further treatment (n = 6), and two experimental groups receiving Astragalus-derived peptide at doses of 5 mL/kg and 10 mL/kg, respectively (ADP 1 and ADP 2; n = 6 per group). The ADP-treated groups received intraperitoneal injections daily at 2 PM, with doses adjusted based on body weight. The injection doses were determined based on the “Guidelines for toxicity testing of drugs” (Ministry of Food and Drug Safety, Notification No. 2017-71, August 30, 2017) [15].

6) Measurement of cytokine production

To measure the production of inflammatory cytokines, such as IL-6, IL-1β, and TNF-α, 100 µL of the prepared cell culture supernatant or animal serum was added to a 96-well plate provided in the assay kit and incubated at room temperature for 2 hours. After incubation, the reagents were discarded, and the plate was washed four times with washing buffer. Moreover, 100 µL of the detection antibody was added and incubated for 2 hours at room temperature. Then, 100 µL of streptavidin-Horseradish Peroxidase was added to each well and incubated for 30 minutes at room temperature. Tetramethylbenzidine or pink-ONE solution (100 µL) was added and incubated for 15 minutes, followed by 100 µL of stop solution. Subsequently, absorbance was measured at 450 nm using a microplate reader, and cytokine production was quantified based on a standard curve.

7) Measurement of the prostaglandin E2 production

To evaluate the production of PGE2, 150 µL of the prepared cell culture supernatant or animal serum and 50 µL of the primary antibody were added to a 96-well plate and incubated at room temperature for 1 hour. Then, 50 µL of conjugates were added and incubated for 2 hours. The reagents were then discarded, and the plate was washed thrice with washing buffer. Subsequently, 200 µL of substrate solution was added to each well and incubated for 30 minutes at room temperature. Then, 100 µL of stop solution was added, the absorbance was measured at 450 nm, and the PGE2 production was analyzed based on a standard curve.

8) Measurement of the gene expression

The total RNA was extracted from the cells and spleen tissue using a total RNA prep kit (iNtRON Biotechnology). The extracted RNA was mixed with a reverse transcription premixed solution that was subjected to a reaction at 45℃ for 60 minutes and 95℃ for 5 minutes for cDNA synthesis. The expression of specific genes, such as iNOS, COX-2, IL-6, IL-1β, and TNF-α, was confirmed via real-time PCR. The reaction mixture included cDNA, SYBR green premix, and gene-specific primers. The amplification protocol had a duration of 2 minutes at 95℃, followed by 40 cycles of 5 seconds at 95℃ and 30 seconds at 62.5℃. The gene expression levels were quantified relative to the control group. Table 1 shows the primer sequences.

Table 1 . Real-time PCR primer sequences.

Gene name	Size (bp)	F/R	Sequences
iNOS	108	F	CTTGGTGAAGGGACTGAGCTG
		R	CAACGTTCTCCGTTCTCTTGC
COX-2	93	F	CAACACCTGAGCGGTTACCA
		R	TTCAGAGGCAATGCGGTTCT
IL-1β	95	F	GCCACCTTTTGACAGTGATGAG
		R	GACAGCCCAGGTCAAAGGTT
IL-6	106	F	AGCCAGAGTCCTTCAGAGAGAT
		R	GAGAGCATTGGAAATTGGGGT
TNF-α	97	F	ATGGCCTCCCTCTCATCAGT
		R	TTTGCTACGACGTGGGCTAC
β-actin	88	F	GCAAGCAGGAGTACGATGAGT
		R	AGGGTGTAAAACGCAGCTCAG

PCR, polymerase chain reaction; F/R, forward/reverse; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2; IL, interleukin; TNF, tumor necrosis factor..

9) Protein expression measurement

The proteins were extracted from cells and spleen tissue using RIPA buffer containing protease inhibitor cocktail I and phosphatase inhibitors II and III. The protein concentration was determined using a BCA Protein Assay Kit. The protein samples were mixed with sample loading buffer heated at 95℃ for 5 minutes. The proteins were separated by Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis on a 10% acrylamide gland transferred to a Polyvinylidene Fluoride membrane. The membrane was blocked with 3% BSA for 2 hours at room temperature and incubated with primary antibodies specific to NF-κB, JNK, p38, iNOS, and COX-2 at 4℃ for 16 hours. After washing the membrane thrice with TBS-T buffer, secondary antibodies were applied and incubated for 1 hour at room temperature. After a final wash, the protein bands were visualized using the Enhanced Chemiluminescence Solution. The protein expression was analyzed using ChemiDoc Fusion FX, and the results were normalized against β-actin as the internal control.

3. Statistical analysis

The results were expressed as mean ± standard deviation. Statistical analysis was performed using SPSS Statistics version 21.0 (IBM). The comparisons between the two groups were performed using an independent sample t-test, whereas the comparisons among the multiple groups were conducted using analysis of variance. A post hoc analysis was performed using Tukey’s honest significant difference test with a significance level of 0.05. Statistical significance was set at p-values of < 0.05, < 0.01, and < 0.001.

1. In vitro experimental results

1) Cell viability

ADP showed no significant toxicity at concentrations up to 10%. However, at concentrations > 20%, the cell viability dropped < 85%, indicating toxicity. Therefore, the subsequent experiments used concentrations of up to 10% to avoid the effects of toxicity (Fig. 1).

Figure 1. Cell viability of ADP in RAW264.7 cells. The results were expressed as mean ± standard deviation of the mean from the three independent experiments (significance of the results: ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture.

2) Intracellular nitric oxide production

The measurement of intracellular NO production revealed that ADP caused a concentration-dependent reduction at concentrations > 5%, indicating a significant decrease compared with the control group (Fig. 2).

Figure 2. Effect of ADP on the nitric oxide level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide.

3) Intracellular prostaglandin E2 production

The measurement of intracellular PGE2 production revealed that ADP caused a concentration-dependent reduction at concentrations > 5%, indicating a significant decrease compared with the control group (Fig. 3).

Figure 3. Effect of ADP on the PGE2 level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group; ***p < 0.001, **p < 0.01 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; PGE2, prostaglandin E2.

2. Intracellular cytokine production

1) Interleukin-1 beta

ADP significantly reduced the intracellular IL-1β levels at a 10% concentration compared with the control group. Moreover, a reduction was observed at a 5% concentration, but it was not statistically significant (Fig. 4).

Figure 4. Effect of ADP on the IL-1β level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, *p < 0.1 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

2) Interleukin-6

The measurement of intracellular IL-6 production revealed that ADP caused a concentration-dependent reduction at concentrations > 5%, indicating a significant decrease compared with the control group (Fig. 5).

Figure 5. Effect of ADP on the IL-6 level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group; ***p < 0.001, **p < 0.01 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

3) Tumor necrosis factor-alpha

The measurement of intracellular TNF-α production revealed that ADP caused a significant reduction at concentrations > 5% compared with the control group (Fig. 6).

Figure 6. Effect of ADP on the TNF-α level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group; **p < 0.01, *p < 0.1 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; TNF, tumor necrosis factor.

3. Intracellular gene expression

1) Inducible nitric oxide synthase

The measurement of intracellular iNOS gene expression revealed that ADP caused a concentration-dependent reduction at concentrations > 5%, indicating a significant decrease compared with the control group (Fig. 7).

Figure 7. Effect of ADP on the iNOS mRNA expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, **p < 0.01 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; iNOS, inducible nitric oxide synthase.

2) Cyclooxygenase-2

The measurement of intracellular COX-2 gene expression revealed that ADP caused a significant reduction at concentrations > 5% compared with the control group (Fig. 8).

Figure 8. Effect of ADP on the COX-2 mRNA expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; COX-2, cyclooxygenase-2.

3) Interleukin-1 beta

The measurement of intracellular IL-1β gene expression revealed that ADP caused a significant reduction at concentrations > 5% compared with the control group (Fig. 9).

Figure 9. Effect of ADP on the IL-1β mRNA expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared to the normal group, *p < 0.1 compared with the ADP non-treated group); *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

4) Interleukin-6

The measurement of intracellular IL-6 gene expression revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 10).

Figure 10. Effect of ADP on the IL-6 mRNA expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, *p < 0.1 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

5) Tumor necrosis factor-alpha

The measurement of intracellular TNF-α gene expression revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 11).

Figure 11. Effect of ADP on the TNF-α mRNA expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group; **p < 0.01, *p < 0.1 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; TNF, tumor necrosis factor.

4. Intracellular protein expression

1) Inducible nitric oxide synthase

The measurement of intracellular iNOS protein expression revealed that ADP caused a significant reduction at concentrations > 5% compared with the control group (Fig. 12).

Figure 12. Effect of ADP on the iNOS protein expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; iNOS, inducible nitric oxide synthase.

2) Cyclooxygenase-2

The measurement of intracellular COX-2 protein expression revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 13).

Figure 13. Effect of ADP on the COX-2 protein expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; COX-2, cyclooxygenase-2.

3) Interleukin-1 beta

The measurement of intracellular IL-1β protein expression revealed that ADP caused a significant reduction at a 10% concentration compared with the control group. Moreover, a decrease was observed at a 5% concentration, but it was not statistically significant (Fig. 14).

Figure 14. Effect of ADP on the IL-1β protein expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

4) Interleukin-6

The measurement of intracellular IL-6 protein expression revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 15).

Figure 15. Effect of ADP on the IL-6 protein expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; IL, interleukin.

5) Tumor necrosis factor-alpha

The measurement of intracellular TNF-α protein expression revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 16).

Figure 16. Effect of ADP on the TNF-α protein expression level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide; TNF, tumor necrosis factor.

5. Intracellular protein phosphorylation

1) ERK

The measurement of ERK protein phosphorylation revealed that ADP did not cause significant changes at any concentration compared with the control group (Fig. 17).

Figure 17. Effect of ADP on the ERK protein phosphorylation level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group); ^#p-value for the between-group comparison using the independent t-test. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide.

2) JNK

The measurement of JNK protein phosphorylation showed that ADP caused a significant reduction at a 10% concentration compared with the control group (Fig. 18).

Figure 18. Effect of ADP on the JNK protein phosphorylation level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group, ***p < 0.001 compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide.

3) p38

The measurement of p38 protein phosphorylation revealed that ADP caused a concentration-dependent and significant reduction at concentrations > 5% compared with the control group (Fig. 19).

Figure 19. Effect of ADP on the p38 protein phosphorylation level in LPS-induced RAW264.7 cells. The results were expressed as the mean ± standard deviation of the mean from the three independent experiments (significance of the results: ^###p < 0.001 compared with the normal group; ***p < 0.001, **p < 0.01, compared with the ADP non-treated group); ^#p-value for the between-group comparison using the independent t-test; *p-value for the among-group comparison using analysis of variance. ADP, Aconitum ciliare Decaisne pharmacopuncture; LPS, lipopolysaccharide.

ACD, a perennial herb in the Ranunculaceae family, is derived from the dried tubers of plants in the same genus [16]. Based on previous studies, ACD has therapeutic effects on severe conditions, such as rheumatic arthritis, osteomyelitis, hemiplegia, peripheral vascular disease, sciatica, tumors, and bi syndrome [17]. ACD contains highly toxic alkaloids, including aconitine, hypaconitine, mesaconitine, and deoxycarnitine [18]. Of these, aconitine can cause acute poisoning at a dose of 0.2 mg and can be fatal at 3–4 mg, necessitating great caution in its use [19]. Various decoction methods, processing techniques, and administration methods have been developed to reduce the risks associated with ACD. One of these methods is ADP, which is based on the acupuncture therapy first introduced in Nam Sang-chun’s 1967 book Meridian volumes 1 and 2 [20]. This method significantly reduces toxicity by converting aconitine to aconine during production, making it a safe for administration. Moreover, research has been conducted on the appropriate dosage and frequency [21] and the physiological activity after administration [22] to improve the safety and efficacy of Chuanwu. Several studies have reported its effectiveness in conditions, such as spinal nerve ligation [23], cancer pain [24], and rotator cuff tears [25]. Therefore, although ADP is expected to have anti-inflammatory effects on chronic inflammation, various diseases and pains caused by chronic inflammation after the procedure’s safety is ensured, its impact on infectious acute inflammatory diseases has not yet been fully investigated. Thus, an in vitro experiment was conducted to determine the acute inflammation treatment effects and mechanisms of ADP based on ACD.

To investigate the intracellular anti-inflammatory effects of ADP in vitro, RAW 264.7 cells, a mouse-derived macrophage cell line, were used. First, ADP was applied at concentrations of 5%, 10%, and 20% and incubated for 24 hours to measure the cell viability (Fig. 1). The results revealed that ADP did not exhibit significant toxicity at concentrations < 10%. However, at concentrations > 20%, the cell viability dropped < 85%, indicating toxicity. Consequently, subsequent experiments were conducted on concentrations of 10% to exclude the findings resulting from toxicity (Fig. 1). The cells for analysis were treated with ADP at concentrations of 5% and 10% and further incubated with 500 ng/mL of LPS for 24 hours. The cell culture supernatants and cells were separated for analysis, and the inflammatory indicators were assessed to understand their efficacy and mechanisms.

The experimental results confirmed that NO and PGE2 production in the ADP-treated groups decreased in a concentration-dependent manner. Notably, a significant inhibition of NO and PGE2 production was observed at ADP concentrations of ≥ 5% (Fig. 2). This suggests that ADP can inhibit the production of inflammatory mediators in LPS-induced inflammation through the NF-κB and MAPK signaling pathways. Moreover, the intracellular levels of IL-1β, IL-6, and TNF-α decreased in a concentration-dependent manner. Significant reductions in IL-1β were observed at 10% concentration. In comparison, significant decreases in IL-6 and TNF-α were confirmed at concentrations of ≥ 5% (Fig. 4). This suggests that ADP inhibits the expression of inflammatory cytokines through the NF-κB and MAPK pathways. The gene and protein expression levels of iNOS and COX-2 also decreased in a concentration-dependent manner. Specifically, the iNOS and COX-2 expression were significantly reduced at concentrations of ≥ 5% (Figs. 7, 8). This suggests that ADP can inhibit the production of NO and PGE2 through iNOS and COX-2. Although the phosphorylation levels of the ERK protein did not show significant difference, the phosphorylation levels of JNK and p38 were significantly decreased in the ADP-treated groups. Notably, JNK phosphorylation was significantly reduced at 10% concentration, whereas p38 phosphorylation showed a significant reduction at concentrations of ≥ 5% (Figs. 18, 19). This suggests that ADP may regulate the inflammatory response through JNK and p38.

The therapeutic significance of ADP in the LPS-induced acute inflammatory response was explained based on the inflammation progression process. ADP tends to inhibit the production of inflammatory mediators and cytokines through the NF-κB and MAPK pathways, reducing the key elements of inflammation, such as NO, PGE2, IL-1β, IL-6, TNF-α, iNOS, and COX-2. It also plays a vital role in regulating the inflammatory response by inhibiting the phosphorylation of JNK and p38. Through this process, ADP can potentially treat inflammatory diseases by suppressing excessive inflammatory responses.

In this study, ADP has been shown to effectively inhibit the LPS-induced acute inflammatory response. The in vitro experimental results revealed that ADP reduced the production of inflammatory mediators and cytokines (e.g., NF-κB, NO, PGE2, IL-1β, IL-6, TNF-α, iNOS, and COX-2) in a concentration-dependent manner and played a crucial role in regulating acute inflammation by inhibiting JNK and p38 phosphorylation. These results suggest that ADP can potentially treat inflammatory diseases. However, this study is a preliminary investigation into the safety and efficacy of ADP through meridian injection, which was primarily conducted on cells. Therefore, clinical research utilizing acupuncture points commonly used in traditional Korean medicine is necessary to assess ADP’s effect on humans. Additional, studies that assess the long-term safety and effectiveness of ADP are warranted. Moreover, identifying the precise mechanism of action of ADP and determining the optimal therapeutic concentration are essential.

In vitro experiments were performed to investigate the anti-inflammatory effects of ADP, which made the following conclusions:

1. ADP exhibited no cytotoxicity at concentrations of ≤ 10%.

2. The measurement of intracellular NO production revealed a significant, concentration-dependent reduction in the NO levels at ADP concentrations > 5% compared with the control group.

3. The intracellular levels of PGE2, IL-6, and TNF-α were significantly reduced in a concentration-dependent manner at concentrations > 5%, with IL-1β showing a significant decrease at 10% concentration compared with the control group.

4. The gene expression levels of iNOS, COX-2, and cytokines (IL-1β, IL-6, and TNF-α) were significantly reduced in a concentration-dependent manner at concentrations > 5% compared with the LPS group.

5. The protein expression levels of IL-1β were significantly reduced at ADP concentrations of ≥ 10% compared with the control group. Conversely, the protein levels of iNOS, COX-2, IL-6, and TNF-α were significantly reduced in a concentration-dependent manner at concentrations > 5% compared with the control group.

6. The measurement of protein phosphorylation levels revealed no significant change in the ERK protein levels compared with the control group; however, the p38 protein levels decreased significantly at 5% concentration of ADP. Moreover, the JNK protein levels decreased significantly at 10% concentration of ADP in a concentration-dependent manner.

This work was originally submitted as a doctoral dissertation at Dongshin University’s College of Korean Medicine.

Conceptualization: YGS, JHK. Data curation: SKI, YGS. Formal analysis: YGS, SKI. Investigation: YGS, SKI, RJ, DYK. Methodology: YGS, JHK. Project administration: YGS, SKI, JHK, SPB. Supervision: JHK, JCS, SPB. Visualization: YGS, SKI. Validation: YGS, SKI, RJ, DYK. Writing–original draft: YGS, JHK, JCS. Writing–review & editing: YGS, JHK, JCS.

The authors have no known conflicts of interest to disclose.

None.

This research did not involve any human or animal experimentation.