Normal cells constantly receive various stimuli from the external environment, such as infrared radiation, hormones, and viral infections [1], causing cellular changes, including the production of reactive oxygen species (ROS) within cells. If not eliminated, these persistent free radicals can lead to oxidative stress [2]. Over time, oxidative stress accelerates aging, triggers skin pigmentation, damages genes and proteins, results in severe metabolic abnormalities, and contributes to conditions, such as liver cirrhosis, fatty liver disease, cardiovascular diseases, and even fatal diseases like cancer [3].

Inflammation is a natural reaction to an irritant, which engages the immune cells, blood vessels, and inflammatory mediators during the process. Inflammation suppresses cellular damage in the initial stages, removes damaged tissues and necrotic cells at the site of injury, and simultaneously promotes tissue regeneration. Substances that trigger inflammatory responses include pathogens, damaged cells, irritants, and danger signals [4]. In particular, mediators involved in the inflammatory response are typically cytokines, including tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and interleukin-6 (IL-6). The secretion of cytokines initiates the inflammatory response [5]; this is followed by the vasodilation of blood vessels in the inflammatory area and an increase in capillary permeability, which leads to redness and heat, and accumulation of tissue fluid that is associated with swelling. Furthermore, excessive inflammatory responses can lead to sepsis and disseminated intravascular coagulation, and chronic inflammation is also considered a risk factor for various diseases, such as atherosclerosis, degenerative joint disease, and periodontal disease.

Dusokohwaeum (DOE) was introduced in the year 1984 by Kim and Lee [6] in their book “CheongKang EuiGam,” which introduced the treatment for pain and paralytic diseases. DOE has been proven to treat “pain, arthralgia, and stroke” with “cold and dampness accumulation” as well as “heavy and uncomfortable pain in the lower back (or lumbar) with phlegm that impairs internal circulation”. Its prescription is a variation of Ojuck-san and consists of Changchul, Duchung, Wooseul, Sokdan, Choengpi, Banha, Bokryung, Danggui, Jakyak, Chungung, Hubak, Gyeji, Saenggang, and Gamcho. The effects of the ingredients are as follows: Changchul facilitates dehumidification; Duchung soothes the meridians; Wooseul regulates the lower body energy; Choengpi regulates the meridians; Choengpi, Banha, and Bokryung facilitate dampness removal; and Danggui, Jakyak, and Chungung promote blood circulation.

Recently, research on antioxidants and anti-inflammatory agents has predominantly focused on a single herb, resulting in a lack of studies related to prescriptions. Thus, this study was conducted to confirm the antiseptic and soothing effects of DOE and its effectiveness in inhibiting and treating inflammatory effects, such as redness, pain, edema, hot flashes, and decreased function.

In this study, RAW264.7 macrophages were used to investigate the antioxidant and anti-inflammatory effects of DOE, and significant results were obtained and reported accordingly.

1. Material

In this study, DOE was used, and its constituent herbs were procured from the Korean herbal medicine distributor Omni Herb Corporation. Table 1 shows the composition of DOE.

Table 1 . The prescription of Dusokohwaeum.

Herbal medicine name	Scientific name	Origin	Weight (g)
Changchul	Atractylodes chinensis Koidzumi	China	8
Duuchung	Eucommia ulmoides Oliver	China	4
Wooseul	Achyranthes japonica Nakai	Korea	4
Sokdan	Phlomis umbrosa Turczaninow	Korea	4
Choengpi	Citrus unshiu Markovich	Korea	4
Banha	Pinellia ternata Breitenbach	China	4
Bokryung	Poria cocos Wolf	Korea	4
Danggui	Angelica gigas Nakai	Korea	4
Jakyak	Paeonia lactiflora Pallas	Korea	4
Chungung	Cnidium officinale Makino	Korea	4
Hubak	Magnolia officinalis Rehder	China	4
Gyeji	Cinnamomum cassia Presl	Korea	4
Saenggang	Zingiber officinale Roscoe	Korea	3
Gamcho	Glycyrrhiza uralensis Fischer	Korea	2
Total amount			57

The following reagents were used: gallic acid (Sigma-Aldrich), Folin–Ciocalteu’s phenol reagent (Merck), quercetin (Sigma-Aldrich), ethanol (Merck), sodium carbonate (Sigma-Aldrich), aluminum nitrate nonahydrate (Sigma-Aldrich), potassium acetate solution (Sigma-Aldrich), 1,1-diphenyl-2-picrylhydrazyl (DPPH; Sigma-Aldrich), 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS; Sigma-Aldrich), Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco), fetal bovine serum (FBS; Gibco), penicillin-streptomycin (Sigma-Aldrich), Dulbecco’s phosphate-buffered saline (Welgene), trypan blue (Sigma-Aldrich), lipopolysaccharides from Escherichia coli O111:B4 (Sigma-Aldrich), EZ-Cytox (DAILAB), 2′,7′-dichlorofluorescin diacetate (DCF-DA; Sigma-Aldrich), Nitric Oxide Plus Detection Kit (iNtRON Biotechnology), easy-spin^TM Total RNA Extraction Kit (iNtRON Biotechnology), AccuPower^® CycleScript RT Premix (dT20) (Bioneer), qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems), DEPC-DW (Bioneer), prostaglandin E2 (PGE2) Parameter Assay Kit (R&D Systems), Mouse IL-1β ELISA Kit (Koma Biotech), Mouse IL-6 ELISA Kit (Koma Biotech), Mouse TNF-α ELISA Kit (Koma Biotech), RIPA lysis and extraction buffer (Thermo Fisher Scientific Inc.), protease inhibitor cocktail (Sigma-Aldrich), phosphatase inhibitor cocktail 2 (Sigma-Aldrich), phosphatase inhibitor cocktail 3 (Sigma-Aldrich), Pierce^TM BCA Protein Assay Kit (Thermo Fisher Scientific Inc.), sample buffer (ELPIS Biotech), 30% bis-acrylamide solution (29:1; iNtRON Biotechnology), 1.5 M Tris-HCl, pH 8.8 w/SDS (iNtRON Biotechnology), 0.5 M Tris-HCl, pH 6.8 w/SDS (iNtRON Biotechnology), 10% ammonium persulfate (Thermo Fisher Scientific Inc.), TEMED (Bio-Rad), 10X Tris-glycine-SDS buffer (iNtRON Biotechnology), GangNam-STAIN^TM prestained protein ladder (iNtRON Biotechnology), 10X transfer buffer (iNtRON Biotechnology), methyl alcohol (Samchun Chemicals), 10X TBS with Tween 20 (iNtRON Biotechnology), ultrapure bovine serum albumin (GenDEPOT), inducible nitric oxide synthase (iNOS) (D6B6S) Rabbit mAb (Cell Signaling), Cox2 (D5H5) Rabbit mAb (Cell Signaling), IL-1β (D6D6T) Rabbit mAb (Cell Signaling), IL-6 (D5W4V), Rabbit mAb (Cell Signaling), TNF-α (D2D4) Rabbit mAb (Cell Signaling), Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP^® Rabbit mAb (Cell Signaling), p44/42 MAPK (Erk1/2) (137F5) Rabbit mAb (Cell Signaling), Phospho-SAPK/JNK (Thr183/Tyr185) (G9) Mouse mAb (Cell Signaling), SAPK/JNK antibody (Cell Signaling), Phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP^® Rabbit mAb (Cell Signaling), p38 MAPK antibody (Cell Signaling), β-actin antibody (Cell Signaling), peroxidase-conjugated AffiniPure goat anti–rabbit IgG (H + L) (Jackson ImmunoResearch), peroxidase-conjugated AffiniPure goat anti–mouse IgG (H + L) (Jackson ImmunoResearch), and Miracle-Star^TM Western Blot Detection System (iNtRON Biotechnology).

The following equipment were used: extraction mantle (Misung Scientific), rotary vacuum evaporator (EYELA), freeze-dryer (ilShinbiobase), CO₂ incubator (Sanyo), clean bench (Vision Scientific), autoclave (Sanyo), vortex mixer (Vision Scientific), centrifuge (Vision Scientific), deep- freezer (Sanyo), ice maker (Vision Scientific), plate shaker (Lab-Line), Luminex (Millipore), microplate reader (Molecular Devices), flow cytometry system (Becton, Dickinson and Company), NanoDrop (Thermo Fisher Scientific Inc.), PCR cycler (alpha cycler 1 PCRmax: PCRmax), real-time PCR cycler (Exicycler^TM 96; Bioneer), and ChemiDoc imaging system (fusion FX; Vilber Lourmat).

2. Methods

Two portions of DOE (114 g) were extracted with 1 L of distilled water at a temperature of 100℃ for 3 hours, the resulting extract was filtered using a filter paper. The filtrate was subjected to vacuum concentration using a rotary vacuum evaporator, followed by freeze-drying using a freeze-dryer. After the freeze-drying process, 15.48 g of powder was obtained (13.57% yield), which was stored at a temperature of −20℃, subdivided on the day of the experiment, and dissolved in distilled water for use.

The mouse-derived macrophage cell line RAW264.7 was purchased from the Korean Cell Line Bank and incubated in a cell incubator maintained at 5% CO₂ and 37℃ using DMEM supplemented with 10% FBS. The cells were subcultured every 2–3 days.

The RAW264.7 cells were incubated in a 48-well plate with a cell concentration of 2 × 10⁴ cells/well for 24 hours. Subsequently, the cells were treated with DOE with concentrations of 100, 200, 400, and 800 μg/mL and cultured for an additional 24 hours. EZ-Cytox solution (10 μL per 100 μL of culture medium) was added to each well, and the cells were incubated in the cell incubator for 30 minutes. Then, absorbance was measured at 450 nm, and cell viability relative to the control group was expressed in percentage.

First, to determine the total flavonoid content, DOE was prepared at a concentration of 1 mg/mL, and 0.5 mL of 50% Folin–Ciocalteu’s phenol reagent was added to 1 mL of the sample, followed by a 3-minutes reaction at room temperature. Subsequently, 1 mL of saturated Na²CO₃ solution and 7.5 mL of distilled water were sequentially mixed into the reaction solution and allowed to stand for 30 minutes. The solution was subjected to centrifugation at 14,000 × g for 10 minutes, and the supernatant was collected. The absorbance of the supernatant was measured at 760 nm. The total phenol content was determined based on the calibration curve prepared using gallic acid as the standard.

Second, to determine the total flavonoid content, DOE was prepared at a concentration of 1 mg/mL. A mixture of 0.1 mL of the sample and 0.9 mL of 80% ethanol was prepared, to which 0.1 mL of 10% aluminum nitrate and 0.1 mL of 1 M potassium acetate were added. After adding 4.3 mL of 80% ethanol, the mixture was allowed to stand at ambient temperature for 40 minutes. Subsequently, the absorbance was measured at 415 nm. The content was determined using a standard curve prepared with quercetin as the reference compound.

Third, to validate the assessment of the DPPH radical erasure ability, DOE was diluted to final concentrations of 1, 10, 100, and 1,000 μg/mL. Subsequently, 0.2 mM DPPH solution dissolved in ethanol (150 μL) was mixed with 100 μL of each sample and allowed to react at 37℃ for 30 minutes. Next, absorbance was measured at 517 nm. Distilled water was used as the control for the samples, and ethanol was used as the control for the DPPH solution to obtain the correction values. The DPPH radical scavenging activity was determined using the following formula:

Fourth, to confirm the assessment of the ABTS radical scavenging activity, DOE was diluted to final concentrations of 1, 10, 100, and 1,000 μg/mL. Subsequently, ABTS solution was prepared by mixing 7.4 mM ABTS and 2.6 mM potassium persulfate, and the mixture was allowed to stand for a day to form the cation (ABTS+). The ABTS solution was further diluted until the absorbance value at 732 nm was ≤ 1.5. Subsequently, 150 μL of the diluted ABTS+ solution was mixed with 5 μL of each sample, and the mixture reaction was observed at room temperature for 10 minutes. The absorbance was measured at 732 nm. The ABTS radical scavenging activity was determined using the following formula:

Fifth, to measure the amount of ROS produced, RAW264.7 cells were placed onto a 6-well plate, with each well containing a density of 1 × 10⁵ cells, and incubated for a period of 24 hours. Subsequently, the cells were treated with DOE with concentrations of 100, 200, and 400 μg/mL, and 200 ng/mL of LPS was applied. The cells were cultured continuously for 24 hours. After all cultures were performed, the cells were collected by centrifugation and washed with cold PBS. Then, they were incubated with 10 μM DCF-DA in the cell incubator for 15 minutes, followed by a second wash with cold PBS to eliminate any remaining DCF-DA. ROS production was analyzed using flow cytometry.

First, to measure nitric oxide (NO) production, RAW264.7 cells were seeded in a 48-well plate with a cell concentration of 2 × 10⁴ cells/well and cultured for 24 hours. Subsequently, the cells were treated with DOE with concentrations of 100, 200, and 400 μg/mL, and 200 ng/mL of LPS was applied. The cells were then incubated for 24 hours. After completing all incubations, 100 μL of N1 buffer was introduced into the wells and permitted to undergo a reaction at ambient temperature for 10 minutes. One hundred μL of N2 buffer was applied, and the reaction was incubated for a duration of 10 minutes at room temperature. After the reaction, absorbance was measured at 540 nm.

Second, to measure the cytokine levels, RAW264.7 cells were distributed in a 6-well plate and cultured for a while. After all cultures were completed, 100 μL of the separated cell culture was placed onto a 96-well plate and reacted at room temperature for 2 hours. At ambient temperature, the reagents on the plate were discarded and washed four times with washing buffer. After washing, 100 μL of detection antibody was introduced and reacted at room temperature for 2 hours. At ambient temperature, 100 μL of streptavidin-HRP was applied to each plate and reacted at room temperature for 30 minutes. Moreover, at ambient temperature, 100 μL of TMB or pink-ONE solution was introduced to each well and reacted for 15 minutes, and 100 μL of stop solution was applied. Furthermore, the absorbance was measured at 450 nm using a micro reader and was expressed as an absolute value based on the standard curve.

Third, to measure gene expression, the RAW264.7 cells were cultured in a 6-well plate with a cell concentration of 1 × 10⁵ cells/well for 24 hours. Subsequently, they were treated with DOE with concentrations of 100, 200, and 400 μg/mL, and 200 ng/mL of LPS was applied. After 24 hours of culture, the cells were collected by centrifugation. The total RNA was extracted using a total RNA preparation kit. The extracted RNA was mixed with a reverse transcription premix and subjected to cDNA synthesis at a temperature of 45℃ for 60 minutes, followed by a reaction at a temperature of 95℃ for 5 minutes. The resulting cDNA was used for real-time PCR to amplify specific genes. The cDNA was mixed with primers specific to the target genes and SYBR Green premix. The reaction was performed at a temperature of 95℃ for 2 minutes, followed by 40 cycles at a temperature of 95℃ for 5 seconds and 62.5℃ for 30 seconds to amplify specific genes. Moreover, the gene expression levels were quantified relative to those of the control group. Table 2 shows the details of the primers.

Table 2 . Real-time PCR primer sequences.

Gene name	Size (bp)	F/R	Sequences
iNOS	127	F	GCTCCAGCATGTACCCTCAG
		R	AAGGCATCCTCCTGCCCACT
COX-2	128	F	CCGTGGGGAATGTATGAGCA
		R	GGGTGGGCTTCAGCAGTAAT
IL-1β	135	F	GCCACCTTTTGACAGTGATGAG
		R	ATGTGCTGCTGCGAGATTTG
IL-6	141	F	CCCCAATTTCCAATGCTCTCC
		R	CGCACTAGGTTTGCCGAGTA
TNF-α	129	F	GATCGGTCCCCAAAGGGATG
		R	TTTGCTACGACGTGGGCTAC
β-actin	102	F	CACTGTCGAGTCGCGTCC
		R	CGCAGCGATATCGTCATCCA

PCR, polymerase chain reaction; F/R, forward/reverse..

The results were presented as the standard error of the mean by using SPSS Statistics (version 21.0; IBM Co.). Initially, a statistical comparison between two groups was conducted using an independent sample t-test, whereas a statistical comparison among multiple groups was performed using analysis of variance. Subsequently, statistical significance was determined using Tukey’s honestly significant difference test with the significance level set at a p-value of 0.05, and the results were indicated at three levels of significance: p < 0.05, p < 0.01, and p < 0.001.

1. Total polyphenol content

The total polyphenol content in DOE, measured using gallic acid as the standard, was found to be 23.42 ± 0.64 (mg GAE/g).

2. Total flavonoid content

The total flavonoid content in DOE, measured using quercetin as the standard, was found to be 20.83 ± 0.98 (mg QE/g).

3. DPPH radical scavenging activity

Measurement of DPPH radical scavenging activity revealed that DOE induced a concentration-dependent increase in the scavenging activity with concentrations of 1, 10, 100, and 1,000 μg/mL (2.72 ± 0.69, 5.10 ± 1.47, 7.03 ± 2.57, and 53.44 ± 4.69%, respectively; Fig. 1).

Figure 1. DPPH radical scavenging activity of DOE. The results were expressed as the standard error of the mean from three independent experiments. DPPH, 1,1-diphenyl-2-picrylhydrazyl; DOE, Dusokohwaeum.

4. ABTS radical scavenging activity

Measurement of ABTS radical scavenging activity revealed that DOE induced a concentration-dependent increase in the scavenging activity with concentrations of 1, 10, 100, and 1,000 μg/mL (2.61 ± 0.03, 6.12 ± 0.61, 14.13 ± 2.63, and 91.11 ± 0.53%, respectively; Fig. 2).

Figure 2. ABTS radical scavenging activity of DOE. The results were expressed as the standard error of the mean from three independent experiments. ABTS, 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid); DOE, Dusokohwaeum.

5. Cell viability

Measurement of cell viability revealed that DOE exhibited cell proliferation at concentrations up to 400 μg/mL, whereas toxicity was observed with concentrations of 800 μg/mL or higher. Subsequent experiments were conducted with concentrations up to 400 μg/mL (Fig. 3).

Figure 3. Cell viability of DOE in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments. DOE, Dusokohwaeum.

6. ROS production

The values of the ROS production were 100.00 ± 0.53% in the control group, 29.64 ± 4.77% in the normal group, and 98.46 ± 3.82%, 85.60 ± 4.93%, and 77.12 ± 5.76% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 200 μg/mL or higher concentrations (Fig. 4).

Figure 4. Effect of DOE on the reactive oxygen species level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; **p < 0.01 compared with control). DOE, Dusokohwaeum.

7. Nitric oxide production

The values of the nitric oxide production were 100.00 ± 6.76% in the control group, 35.33 ± 2.40% in the normal group, and 88.25 ± 2.99%, 78.39 ± 2.67%, and 70.95 ± 3.93% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at ≥ 100 μg/mL concentrations (Fig. 5).

Figure 5. Effect of DOE on the nitric oxide level in RAW264.7 cells. The result were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; **p < 0.01; ***p < 0.001 compared with control). DOE, Dusokohwaeum.

8. Cytokine production

The levels of PGE2 production were 2,059.92 ± 92.82% in the control group, 266.08 ± 69.74% in the normal group, and 1,932.73 ± 71.61%, 1,663.52 ± 68.00%, and 1,438.43 ± 74.21% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 200 μg/mL or higher concentrations (Fig. 6).

Figure 6. Effect of DOE on the PGE2 level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; **p < 0.01; ***p < 0.001 compared with control). DOE, Dusokohwaeum; PGE2, prostaglandin E2.

The levels of the IL-1β production were 272.60 ± 15.90% in the control group, 63.84 ± 9.58% in the normal group, and 266.79 ± 24.43%, 262.97 ± 23.49%, and 215.94 ± 14.39% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. A significant reduction was observed in the 400 μg/mL DOE treatment group when compared with the control group (Fig. 7).

Figure 7. Effect of DOE on the IL-1β level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; **p < 0.01 compared with control). DOE, Dusokohwaeum; IL-1β, interleukin-1 beta.

The levels of the IL-6 production were 653.80 ± 35.59% in the control group, 653.80 ± 35.59% in the normal group, and 511.90 ± 28.16, 468.52 ± 25.78, and 383.97 ± 21.32% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. A dose-dependent reduction was observed at DOE concentrations of 100 μg/mL or higher when compared with the control group (Fig. 8).

Figure 8. Effect of DOE on the IL-6 level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; **p < 0.01; ***p < 0.001 compared with control). DOE, Dusokohwaeum; IL-6, interleukin-6.

The levels of the TNF-α production were 1,644.64 ± 133.39% in the control group, 544.44 ± 86.06% in the normal group, and 1,555.32 ± 74.48%, 1,286.60 ± 58.56%, and 1,141.94 ± 49.85% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 200 μg/mL or higher concentrations (Fig. 9).

Figure 9. Effect of DOE on the TNF-α level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; **p < 0.01 compared with control). DOE, Dusokohwaeum; TNF-α, tumor necrosis factor-alpha.

9. Gene expression levels

The expression levels of iNOS were 1.00 ± 0.03% in the control group, 0.04 ± 0.04% in the normal group, and 0.95 ± 0.05%, 0.82 ± 0.04%, and 0.60 ± 0.04% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 200 μg/mL or higher concentrations (Fig. 10).

The expression levels of COX-2 were 1.00 ± 0.05% in the control group, 0.18 ± 0.05% in the normal group, and 1.00 ± 0.04%, 0.98 ± 0.05%, and 0.89 ± 0.04% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. At 400 μg/mL, DOE induced a significant reduction when compared with the control group (Fig. 11).

The expression levels of IL-1β were 1.00 ± 0.05% in the control group, 0.04 ± 0.01% in the normal group, and 0.91 ± 0.07%, 0.79 ± 0.06%, and 0.66 ± 0.05% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 200 μg/mL or higher concentrations (Fig. 12).

The expression levels of the IL-6 gene were 1.00 ± 0.05% in the control group, 0.11 ± 0.06% in the normal group, and 0.86 ± 0.06%, 0.80 ± 0.06%, and 0.645 ± 0.05% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 100 μg/mL or higher concentrations (Fig. 13).

The expression levels of TNF-α were 1.00 ± 0.04% in the control group, 0.18 ± 0.03% in the normal group, and 0.69 ± 0.03%, 0.57 ± 0.03%, and 0.41 ± 0.04% in the 100, 200, and 400 μg/mL DOE treatment groups, respectively. DOE induced a significant dose-dependent reduction when compared with the control group at 100 μg/mL or higher concentrations (Fig. 14).

Arthralgia refers to pain in the joints, muscles, and skin of the limbs because of pathogenic factors, such as wind, cold, dampness, and heat. It is characterized by abnormal connective tissue conditions. The arthralgia theory in Somun emphasizes that the combination of wind, cold, and dampness as pathogenic factors is a disease. When the pathogenic factor of wind dominates, it becomes “Haengbi”; when the pathogenic factor of cold dominates, it becomes “Tongbi”; and when the pathogenic factor of dampness dominates, it becomes “Chakbi.”

Thus, the cause of arthralgia has been recognized as a disease that requires systemic observation rather than a local cause. DOE is a prescription documented in CheongKang EuiGam for the treatment of pain and arthralgia stroke and is also a variation of Ojuck-san. Ojuck-san is an official formula of the Taepyeonghyemin Hwajegukbang, which possesses these attributes: “harmonizing the center and regulating the Gi, dispelling wind and cold, harmonizing phlegm and fluids, treating the spleen and stomach’s lingering cold, relieving chest congestion with phlegm, alleviating nausea and vomiting, treating external wind-cold, internal injuries from cold, and alleviating discomfort and fullness in the abdomen.” Currently, Ojuck-san has been generally used to treat acute and chronic gastrointestinal diseases, gastrointestinal cramps, lower back pain, neuralgia, rheumatism, leukorrhea, beriberi, stroke, bruises, heart valves, etc., Ojuck-san basically includes Mahwang (Ephedra sinica), which is excluded from the composition in the case of DOE. Mahwang is warm in nature, spicy, and slightly bitter; it is used to treat pain by inducing sweating to relieve symptoms, disseminating lung energy to relieve wheezing, and diureticalness to reduce swelling and dispelling dampness to alleviate pain. However, owing to the strong diaphoretic effect of Mahwang, its use has been contraindicated as it may lead to irritation and harm to the viscera when used for conditions, such as sore throat, exterior deficiency with spontaneous sweating, yin deficiency with night sweats, and lung deficiency with wheezing and coughing. DOE has the advantage of expanding the scope of the treatment application because it can be used safely by physically weak people. Moreover, it has been described to treat pain, arthralgia, and stroke caused by two etiologies, i.e., cold and dampness. For example, Changchul facilitates dehumidification; Duchung soothes the meridians; Wooseul regulates lower body energy, Choengpi regulates the meridians; Choengpi, Banha, Bokryung facilitate dampness removal; and Danggui, Jakyak, and Chungung promote blood circulation. The study aimed to evaluate the antiseptic and soothing effects of DOE in inhibiting and treating inflammatory effects, such as redness, pain, edema, hot flashes, and decreased function.

ROS act on cell membranes composed of lipids and proteins, leading to the peroxidation of unsaturated fatty acids and severe cellular damage. Therefore, ROS are causative factors for not only aging by promoting damage to proteins, DNA, and cell membrane lipids but also various acute and chronic diseases, such as rheumatoid arthritis, heart disease, kidney failure, diabetes, and cancer [7]. The antioxidant defense system can be broadly divided into enzymatic and nonenzymatic defense mechanisms [8]. Glutathione peroxidase (GPX), superoxide dismutase (SOD), and catalase (CAT) are involved in the enzyme defense mechanisms. The nonenzymatic defense mechanisms include the reduction in the toxicity of uric acid, bilirubin, and vitamins C and E by reacting with hydroxyl radicals and singlet oxygen without the help of enzymes [9].

SOD, CAT, and GPX levels are not constant in the body and depend on various factors, such as biological conditions and aging; therefore, it is necessary to strengthen the body’s antioxidant system by consuming nonenzymatic antioxidants [9].

Polyphenols are present not only in vegetables and fruits but also in coffee, tea, and beverages; it is effective in treating diseases owing to its antioxidant and anti-inflammatory effects. Moreover, it improves neurodegenerative diseases, regulates gene expression, and balances the microorganisms in the body. Polyphenols can be broadly divided into flavonoids and nonflavonoids [10]. Flavonoids are secondary plant metabolites and among the most common polyphenol compounds ingested by humans. They are powerful antioxidants that can be obtained from nature because of their strong action as free radical scavengers and reactivity with hydroxyl radicals [11].

Generally, DPPH and ABTS radical scavenging activities are measured to evaluate the antioxidant effects of DOE. To evaluate the antioxidant efficacy of DOE, total polyphenol content, total flavonoid content, DPPH radical, ABTS radical scavenging ability, and intracellular ROS production were measured. The total polyphenol content of DOE was 23.42 ± 0.64 mg GAE/g, whereas the total flavonoid content was 20.83 ± 0.98 mg QE/g. DOE showed an increase in the concentration-dependent scavenging ability and showed the highest increase at 1,000 μg/mL, with a scavenging ability of 53.44 ± 4.69% and 91.11 ± 0.53% for DPPH and ABTS radicals, respectively (Figs. 1, 2). Before measuring the amount of ROS production by treating the LPS-induced RAW264.7 cells with DOE, the viability of the RAW264.7 cells treated with DOE was determined; cells treated with < 400 μg/mL DOE indicated proliferation, and toxicity was observed at a DOE concentration of ≥ 800 μg/mL or and 400 μg/mL in a later experiment (Fig. 3).

DOE treatment resulted in a significant concentration-dependent decrease in ROS production at ≥ 200 μg/mL concentrations and a decrease of 77.12 ± 5.76% in ROS production at 400 μg/mL (Fig. 4). High concentrations of DOE significantly reduced ROS production, in addition to rapidly increasing the radical scavenging ability. However, because DPPH and ABTS radical scavenging ability increased rapidly at 1,000 μg/mL and the cytotoxicity of the RAW264.7 cells was observed at a DOE concentration of ≥ 800 μg/mL or, further research is required to evaluate the antioxidant efficacy of DOE at low concentrations.

Various receptors are activated during the development of inflammation, depending on the type of stimulus and the corresponding signaling substances that are secreted. In the case of macrophages, when stimulation caused by LPS occurs, inflammatory cytokines (TNF-α, IL-1β, and IL-6) are produced to induce an inflammatory response [12]. IL-1β and TNF-α cause changes in the vascular endothelial cells at the site of infection, increasing the diameter of blood vessels and lowering blood flow speed, so that immune cells, such as white blood cells, can migrate to the infected tissues. IL-6 activates the metabolism of muscle and fat cells and generates heat in the infected tissue area [13]. To prevent damage from these stimuli, the body uses strategies to inhibit the signaling process, wherein the expression of COX-2 plays a key role in the inflammatory phase. COX-2 is an enzyme directly involved in the process of transferring arachidonic acid to PGE2 [14], which is an inflammation-inducing signaling molecule that acts on the hypothalamus and causes fever [13].

NOS converts l-arginine to l-citrulline, leading to the formation of NO. Among the NOS mediating this process, iNOS appears in various cells stimulated by LPS and is also expressed by the stimulation of epithelial cells or cytokines infected with bacteria [15]. NO generated by iNOS expression induces an inflammatory response and intensifies it by forming cytokines, such as IL-6, and mediators, such as COX-2 [16].

To test the anti-inflammatory effects of DOE, LPS-induced macrophages (RAW264.7) were used. RAW264.7 cells induced by LPS were treated with DOE, and the NO, PGE2, TNF-α, IL-1β, and IL-6 levels were measured. A significant reduction in NO production was observed at DOE concentrations of more than 100 μg/mL (Fig. 5). Moreover, significant concentration-dependent reductions in the PGE2, TNF-α, IL-1β, and IL-6 levels were observed at DOE concentrations of 200, 400, 100, and 200 μg/mL, respectively (Figs. 6–9). Furthermore, the levels of iNOS and COX-2 expression were assessed, which play a crucial role in NO and PGE2 synthesis, along with the measurement of TNF-α, IL-1β, and IL-6. The results revealed that the iNOS and COX-2 expression levels were concentration-dependent and significantly decreased at DOE concentrations of 200 and 400 μg/mL, respectively (Figs. 10, 11); IL-1β was concentration-dependent and significantly decreased at a DOE concentration > 200 μg/mL; and IL-6 and TNF-α were concentration-dependent and significantly decreased at a DOE concentration of 100 μg/mL or higher (Figs. 12–14).

Figure 10. Effect of DOE on the iNOS mRNA expression level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; ***p < 0.001 compared with control). DOE, Dusokohwaeum; iNOS, inducible nitric oxide synthase.

Figure 11. Effect of DOE on the COX-2 mRNA expression level in RAW264.7 cells. The results were presented as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05 compared with control). DOE, Dusokohwaeum; COX-2, cyclooxygenase-2.

Figure 12. Effect of DOE on the IL-1β mRNA expression level in RAW264.7 cells. The results were as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; **p < 0.01 compared with control). DOE, Dusokohwaeum; IL-1β, interleukin- 1 beta.

Figure 13. Effect of DOE on the IL-6 mRNA expression level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of the results: ⁺⁺⁺p < 0.001 compared with normal; *p < 0.05; **p < 0.01; ***p < 0.001 compared with control). DOE, Dusokohwaeum; IL-6, interleukin-6.

Figure 14. Effect of DOE on the TNF-α mRNA expression level in RAW264.7 cells. The results were expressed as the standard error of the mean from three independent experiments (significance of results: ⁺⁺⁺p < 0.001 compared with normal; ***p < 0.001 compared with the control). DOE, Dusokohwaeum; TNF-α, tumor necrosis factor-alpha.

Our findings confirmed the antioxidant and anti-inflammatory effects of DOE and suggested its potential applicability against various inflammatory conditions in clinical practice. However, because of the limitations of the cell experiments and severe lack of research related to DOE, further DOE experiments need to be designed and performed in the future. Furthermore, future in vivo experiments for osteoarthritis and rheumatoid arthritis, which are inflammatory diseases that are commonly observed in clinical practice, are needed to confirm our findings.

The assessment of the antioxidant and anti-inflammatory effects of DOE on LPS-induced RAW264.7 cells yielded the following conclusions: First, notably, the significant concentrations of DOE were 23.42 ± 0.64 mg GAE/g and 20.83 ± 0.98 mg QE/g, respectively. Second, DOE showed a concentration-dependent increase in scavenging ability in the DPPH and ABTS radical scavenging ability experiments. Third, production of intracellular ROS and NO was significantly reduced in the presence of DOE. Forth, production of inflammatory cytokines (PGE2, TNF-α, IL-1β, and IL-6) was significantly reduced in the presence of DOE. Fifth, the expression levels of iNOS, COX-2, TNF-α, IL-1β, and IL-6 were significantly decreased in the presence of DOE.

These findings confirm the antioxidant and anti-inflammatory effects of DOE, indicating its potential for clinical application in managing various chronic and refractory diseases.

Conceptualization: YGS, SKI. Data curation: SKI, JMJ. Formal analysis: YGS, SKI. Investigation: YGS, SKI, JMJ, JN. Methodology: JSY, YGS. Project administration: YGS, SKI. Supervision: JHK, SPB. Validation: JSY, JCS. Visualization: YGS, SKI. Writing – original draft: YGS. Writing – review & editing: YGS, JHK, JCS.

The authors have no conflicts of interest to declare.

None.

This research did not involve any human or animal experimentation.